You can search the internet for my other English Medium article as well. Gujarat Biology and India Biology You can also give tests from there. Also got the more information about NEET BIOLOGY
NEET BIOLOGY
Biology for NEET
Biology Short Notes
Biology Test
CBSE/ BOARD Examination
DPP-5
1. Which of the following observations of Hershey and Chase experiment proved that DNA is genetic material?
(a) The bacteriophage labelled with radioactive sulphur made the bacterial DNA radioactive.
(b) The bacteriophage labelled with radioactive phosphorus did not make bacteria radioactive.
(c) Bacteriophage labelled with radioactive sulphur made only the bacterial proteins radioactive.
(d) Bacteriophage labelled with radioactive phosphorus made the bacterial DNA radioactive.
2. Identify the correct sequence of DNA packaging in terms of ascending order of size.
(a) DNA → Nucleosome→ Chromatin fibre→Solenoid→Chromatid→Chromosome
(b) DNA → Nucleosome → Chromatid → Solenoid →Chromatin fibre → Chromosome
(c) DNA→ Nucleosome→ Solenoid → Chromatin fibre → Chromatid → Chromosome
(d) DNA→ Nucleosome → Solenoid → Chromatid→ Chromosome→ Chromatin fibre
3. Which of the following events takes place during post transcriptional modification in eukaryotes?
(a) 7-methyl guanosine cap is added at 3' end of RNA transcript.
(b) Addition of poly A segment at 5' end of transcript.
(c) Exons are removed from primary transcript.
(d) Introns are removed from primary transcript.
4. Select the correct statement regarding repression of genes.
(a) It refers to switching on of operon that usually remains turned off.
(b) It initiates transcription and translation of structural genes.
(c) It involves the blocking of operator gene of operon.
(d) None of these.
5. Arrange the various steps of DNA fingerprinting technique in the correct order.
(i) Separation of DNA fragments by electrophoresis
(ii) Digestion of DNA by restriction endonucleases
(iii) Hybridisation using labelled VNTR probe
(iv) Isolation of DNA
(v) Detection of hybridised DNA fragments by auto-radiography
(vi) Transferring the separated DNA fragments to nitrocellulose membrane
(a) (iv) → (ii) → (i) → (vi) → (iii) → (v)
(b) (iv) → (i) → (ii) → (iii) → (vi) →(v)
(c) (ii) → (i) →(iv) → (vi) → (iii) → (v)
(d) (iii) → (v) → (iv) → (ii) → (i) → (vi)
6. Which of the following mRNA will get translated completely?
(a) AUGUUUCCUCAUUAGGGUGUU
(b) GUGUUUCCUCAUGGUUGAGUU
(c) AUGUUUCCUCAUGGUGUUUCC
(d) AUGUUUCCUUGAAUGGUUUAA
7. Which of the following is incorrect about anticodon?
(a) It helps in bringing a particular amino acid at its proper position during translation.
(b) It occurs only in tRNA.
(c) It is complementary to a codon.
(d) It determines the position of an amino acid in a polypeptide.
8. Which one of the following is not a part of transcription unit?
(a) Promoter
(b) Terminator
(c) Inducer
(d) Structural genes
9. In the experiment of Avery, MacLeod and McCarty, R-type bacteria was converted into S-type bacteria only when R-type bacteria is mixed with
(a) proteins of S-type bacteria
(b) DNA of S-type bacteria with DNase
(c) DNA of S-type bacteria without DNase
(d) carbohydrates of S-type.
10. A bacterial culture of E.coli is transferred to a medium without lactose. Which of the following will occur in such case?
(a) Permease will be produced in high amount only.
(b) Transacetylase and permease will be produced only.
(c) B-galactosidase will be produced only.
(d) Enzymes of lac operon will be produced in a very low level.
(a) The bacteriophage labelled with radioactive sulphur made the bacterial DNA radioactive.
(b) The bacteriophage labelled with radioactive phosphorus did not make bacteria radioactive.
(c) Bacteriophage labelled with radioactive sulphur made only the bacterial proteins radioactive.
(d) Bacteriophage labelled with radioactive phosphorus made the bacterial DNA radioactive.
2. Identify the correct sequence of DNA packaging in terms of ascending order of size.
(a) DNA → Nucleosome→ Chromatin fibre→Solenoid→Chromatid→Chromosome
(b) DNA → Nucleosome → Chromatid → Solenoid →Chromatin fibre → Chromosome
(c) DNA→ Nucleosome→ Solenoid → Chromatin fibre → Chromatid → Chromosome
(d) DNA→ Nucleosome → Solenoid → Chromatid→ Chromosome→ Chromatin fibre
3. Which of the following events takes place during post transcriptional modification in eukaryotes?
(a) 7-methyl guanosine cap is added at 3' end of RNA transcript.
(b) Addition of poly A segment at 5' end of transcript.
(c) Exons are removed from primary transcript.
(d) Introns are removed from primary transcript.
4. Select the correct statement regarding repression of genes.
(a) It refers to switching on of operon that usually remains turned off.
(b) It initiates transcription and translation of structural genes.
(c) It involves the blocking of operator gene of operon.
(d) None of these.
5. Arrange the various steps of DNA fingerprinting technique in the correct order.
(i) Separation of DNA fragments by electrophoresis
(ii) Digestion of DNA by restriction endonucleases
(iii) Hybridisation using labelled VNTR probe
(iv) Isolation of DNA
(v) Detection of hybridised DNA fragments by auto-radiography
(vi) Transferring the separated DNA fragments to nitrocellulose membrane
(a) (iv) → (ii) → (i) → (vi) → (iii) → (v)
(b) (iv) → (i) → (ii) → (iii) → (vi) →(v)
(c) (ii) → (i) →(iv) → (vi) → (iii) → (v)
(d) (iii) → (v) → (iv) → (ii) → (i) → (vi)
6. Which of the following mRNA will get translated completely?
(a) AUGUUUCCUCAUUAGGGUGUU
(b) GUGUUUCCUCAUGGUUGAGUU
(c) AUGUUUCCUCAUGGUGUUUCC
(d) AUGUUUCCUUGAAUGGUUUAA
7. Which of the following is incorrect about anticodon?
(a) It helps in bringing a particular amino acid at its proper position during translation.
(b) It occurs only in tRNA.
(c) It is complementary to a codon.
(d) It determines the position of an amino acid in a polypeptide.
8. Which one of the following is not a part of transcription unit?
(a) Promoter
(b) Terminator
(c) Inducer
(d) Structural genes
9. In the experiment of Avery, MacLeod and McCarty, R-type bacteria was converted into S-type bacteria only when R-type bacteria is mixed with
(a) proteins of S-type bacteria
(b) DNA of S-type bacteria with DNase
(c) DNA of S-type bacteria without DNase
(d) carbohydrates of S-type.
10. A bacterial culture of E.coli is transferred to a medium without lactose. Which of the following will occur in such case?
(a) Permease will be produced in high amount only.
(b) Transacetylase and permease will be produced only.
(c) B-galactosidase will be produced only.
(d) Enzymes of lac operon will be produced in a very low level.
===== Connecting With Me For More Knowledge Of Biology =====
Ans key
1. D, 2.C, 3.D, 4.C, 5.A, 6.C, 7.D, 8.C, 9.C, 10.D,
Download My App just search - Gujarat Biology NEET PLUS on google play store
Link 👇
NEET BIOLOGY
Biology for NEET
Biology Short Notes
Biology Test
CBSE/ BOARD Examination
MANISH MEVADA
M.Sc, M.Phil, B.Ed
GUJARAT BIOLOGY NEET
NEET MATERIAL IN GUJARATI
KNOWLEDGE ON THE WAY.

Please Do Not enter any sparm link in comment box